BP 16 Natalie Peck

From GGCWiki
Jump to: navigation, search


Location of collection: GGC BEAVER POND: Terrestrial insect.
Date of collection: First week of September, 2012
Date Project Began: September, 12, 2012

Shannon-Wiener Index of Biodiversity: Used to measure species richness, and relative abundance.


Contents

Photo:

BP16 Odonata
BP16 Odonata
BP16

Distinguishing morphological features of Order:


- Large clamping mouthpiece with teeth like structures for chewing
- Large eyes
- Large head
- Small antennae
- Segmented/joined pairs of legs legs
- Dark segmented belly
- Fine, hairlike structures protruding from backside


Domain: Eukaryota
Kingdom: Animalia
Class:
Subclass: Acari Leach
Superorder: Acariformes Zakhvatkin
Order: Actinedida
Sub-order: Parasitengona Oudemans
Superfamily: Hygrobatoidea
Family: Pionidae
Genus: Piona

Geographical Distribution:

These insects can be found in open forests and grasslands. Species have the geographic range which include the necessary physical and vegetational conditions.

Life cycle:

The life cycle consists of an egg stage (aquatic environment) followed by nymph stage, then finally maturing into adult insect, living in a terrestrial environment near the water.

Sexual dimorphism:

What it eats:
Larval/nymphal stage --> Small insects, aquatic worms, water mites, detritus, and plants.
Adult stage --> Small insects, aquatic worms, water mites, detritus, and plants.


Habitat:
Larval/nymphal stage --> Aquatic habitat
Adult stage --> Terrestrial habitat


Ecological Importance:
Larval/nymphal stage --> Plant growth stimulation, and nutrient cycling.
Adult stage --> At the adult stage they play an important role in the food chain, and also participate in plant growth stimulation and nutrient cycling.


Economic/agricultural/human health importance:
Larval/nymphal stage -->
Adult stage -->

PCR Product:

Final Gel Picture


Sequence data:


Piona sp. BOLD:AAB8101 voucher MYMCA-02-15 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial


NNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNTGGTATNCTAGGNAGCAAGAATAAGAACTATTATCCGATTAGAACTAGGACAACCAGGNTCTCTTTTAGGAAATGATCAAATTTATAATACTATCGTAACAGCACATGCCTTCGTCATAATTTTTTTTATAGTAATACCTATAATAATCGGAGGATTTGGAAATTGATTAGTACCTCTAATATTAAGAGCCCCAGACATAGCTTTTCCTCGAATAAACAATATAAGTTTTTGAT


Taxonomy ID: 1251541
mitochondrion Piona sp. BOLD:AAB8101


PCR primers: fwd sequence: attcaaccaatcataaagatattgg
reverse sequence: taaacttctggatgtccaaaaaatca
PCR primers fwd sequence: ggtcaacaaatcataaagatattgg
reverse sequence: taaacttcagggtgaccaaaaaatca

Personal tools