BP 9 Elias Malouf

From GGCWiki
Jump to: navigation, search

Contents

Location of Collection

Beaver Pond located on Georgia Gwinnett College Campus

Date of Collection

August 2012

Shannon-Wiener Index of Biodiversity

Pictures

IMG 0386.JPG IMG 0387.JPG IMG 0388.JPG

Distinguishing Morphological Features of Order

  • Eyes tend to be separate in nature.
  • Damselflies have four large membranous wings of nearly equal size.
  • Wings are usually clear however, some species have black or red coloration in the wings.
  • Damselflies have long thin bodies.
  • Bodies are sometimes brightly colored with green, blue, red, yellow, black or brown.
  • Damselflies have oblong heads with bulging eyes and very short antennae.
  • Wings of most damselflies are held along, and parallel to, the body when at rest.
  • The hindwing of the damselfly tends to be similar to the forewing.

Sub-order

Zygoptera

Family

Coenagrionidae

Genus

Unknown

Species

Enallagma sp. BOLD:AAA2218 Common name: Damselfly

Geographical Distribution

  • Often times damselflies are restricted to cool streams or rivers, others to ponds or still clear waters, and some to marshy places.
  • Some species are widespread while others are highly local in their distribution.
  • Species in the family Coenagrionidae can commonly be found around ponds and streams.
  • Damselflies can be found mainly near shallow, freshwater habitats.

Life Cycle

The Egg Stage

  • After mating, the adult damselfly lays her eggs in a protected area in the water.
  • The eggs are about 1 mm long and cylindrical, and are laid in clutches of a few hundred to a few thousand.
  • Depending upon the species, the eggs hatch in about one to three weeks.

The Nymph Stage

  • This stage is typically an aquatic stage for the damselfly.
  • After hatching, the nymph damselfly is 1/4 inch long.
  • The nymph has a slender body and long legs of the adult, but does not have wings.
  • Three external gills are located at the end of its body that look like a tail.

The Adult Stage

  • As adults, damselflies range from about ¾ inch to 1 ¾ inch, depending upon the species.
  • As adults, damselflies live between about three weeks and about seven months, depending on their species.

Sexual Dimorphism

  • Shorter-lived damselflies are sexually mature a few days after they emerge from the nymph stage.
  • Longer-lived damselflies aren't sexually mature for a few months. As soon as they are sexually mature, damselflies return to the water and mate.
  • The adults mate over the shallow water, sometimes in flight but often while clinging to the exposed portions of weed beds or shoreline vegetation.
  • The females may lay a few clutches of eggs during their lifetimes.

What it eats

  • As nymphs, damselflies eat small aquatic animals such as insects, mosquito larva and even small fish and tadpoles.
  • Adult damselflies eat small insects like mosquitoes, flies and aphids.

Habitat

  • Damselfly nymphs are hatched in shallow water and tend to stay in the shallows among weed beds where food is plentiful.
  • Damselfly habitats consist of running water but are seen to prefer the marshes, ponds and lakes.
  • They usually stay in shallow clean water but may be found to depths of 35 feet.

Ecological Importance

  • The damselfly nymph ranks as the sixth most importance food source for trout.
  • Due to their low predatory position on the aquatic food chain, counts of Odonata populations are useful for determining the health of aquatic ecosystems.

Economic, Agricultural, & Human Health Importance

  • Odonate larvae are sometimes used as bait by fishermen, and adults are a minor food item in some countries.

PCR product: Gel Pictures

Labeled Gel BS12.jpg


Wells:
E = Empty well
L = Ladder
(+) = Positive control
(-) = Negative control
9 = Organism BP9

Sequence Data

Forward Sequences:

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGNGNATGANCCGGNATNGTAGGAACTGCCCTGAGAATATTAATTCGAGTTGAATTAGGACAACCTGGATCATTAATTGGAGATGACCAGATTTATAATGTAGTAGTTA
CTGCACATGCATTTGTTATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTGGTACCATTAATATTAGGAGCACCAGATATAGCTTTCCCCCGATTAAATAACATGAGATTCTGACTTTTACCCCCA
TCACTAACCTTATTACTAGCAAGAAGATTAGTAGAAAGAGGGGCTGGGACCGGGTGAACCGTATACCCACCATTAGCAGGTGTAATCGCTCATGCTGGGGCATCCGTTGATTTAACTATTTTTTCATTACACTTAGCAGGAGTA
TCATCAATTTTAGGAGCAATTAATTTTATTACAACTACTATTAATATAAAGTCACCAGGTATAAGTATAGATCAACTACCTTTATTCGTTTGAGCTGTGGTAATTACAGCAGTATTACTTTTATTATCATTACCAGTATTAGCAGG
TGCCATTACGATACTGTTAACAGACCGTAATATTAATACATCGTTCTTTGATCCTGCGGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGNAGNTNAN

Reverse Sequences:

NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTCCCGCAGGANCAAAGAACGATGTATTAATATTACGGTCTGTTAACAGTATCGTAATGGCACCTGCTAATACTGGTAATGATAATAAAAGTAATACTGCTGTAATTAA
CAGCTCAAACGAATAAAGGTAGTTGATCTATACTTATACCTGGTGACTTTATATTAATAGTAGTTGTAATAAAATTAATTGCTCCTAAAATTGATGATACTCCTGCTAAGTGTAATGAAAAAATAGTTAAATCAACGGATGCCCC
AGCATGAGCGATTACACCTGCTAATGGTGGGTATACGGTTCACCCGGTCCCAGCCCCTCTTTCTACTAATCTTCTTGCTAGTAATAAGGTTAGTGATGGGGGTAAAAGTCAGAATCTCATGTTATTTAATCGGGGGAAAGCTAT
ATCTGGTGCTCCTAATATTAATGGTACCAATCAATTTCCAAATCCTCCAATTATAATGGGTATAACTATAAAGAAAATTATAACAAATGCATGTGCAGTAACTACTACATTATAAATCTGGTCATCTCCAATTAATGATCCAGGTT
GTCCTAATTCAACTCGAATTAATATTCTCAGGGCAGTTCCTACTATTCCGGCTCATGCACCAAATATTAAGTATAAAGTACCAATATCTTTNNNNNNNNNNNNACCNNCN

Personal tools