Specimen 229- Manuel Vargas

From GGCWiki
Jump to: navigation, search

Location of collection: GGC 4

Date of collection: August 2012

Shannon-Wiener Index of Biodiversity: H'=3.699

Photo:

229ecology.JPG
229-1ecology.JPG







Distinguishing morphological features of Order:


Their body is often wasp-like, constricted between the thorax and the abdomen. When wings are present they are 4 membranous with the fore wings larger than the hind wings. They have antennas of usually 10 segments. Their body is also segmented. Their mouth parts are well developed mandibles for chewing and some have an elongated labium into a sucking tongue.


Sub-order ? Family ? After sequencing, genus and species ?

Arthropoda Insecta Hymenoptera Formicidae Formica pallidefulva


Geographical Distribution:

Species of Formica inhabit open woodlands or treeless grassland or shrubland.


Life cycle:


Sexual dimorphism: It depends on the number of chromosomes it receives when it is fertilize. Fertilized eggs develop into females when it receives both sets of chromosomes, one from each parent, and unfertilized eggs become males since they only received one set of chromosomes making them haploid males.


What it eats: Most are herbivorous, feeding on leaves and sometimes pine needles


Habitat: They nest in the soil, near moist areas, such as river banks, ponds, near highways, and under objects like rocks and logs.


Ecological Importance:

Control tree pests as swains jack pine sawfly and eastern tent caterpillars in North America.


Economic/agricultural/human health importance:

Control tree pests as swains jack pine sawfly and eastern tent caterpillars in North America.


PCR product: gel picture?


Sequence data: GAAATATAAGTTAATTATTCGATTAAATTAGGTTCTCAATTCATTAATTAATAATGATCAAATTTATAATTCTTTAGTAACTAATCATGCCTTTATTATAATCTTTTTTATAGTAATACCATTTATAATTGGTG GATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCGCCAGATATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCCATCACTCTATTACTTTTAAGAAACTTTATTAATGATGGT ACTGGAACTGGGTGAACTATCTACCCTCCTTTAGCTTCAAATATTTTTCATAATGGGCCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCCGGTATATCATCTATTTTAGGAGCTATTAATTTTATTTC AACAATCCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCCCTACTTGTATGATCTATCTNAATCACTGCAATTTTACTTTTATTATCCCTTCCCGTTTTAGCTGGAGCTATNACAATATTATTAA CTGATCGAAACTTAAATACTTCATTTTTTGATCCTTCAGGAGGGGGAGACCCGATTCTATATCAACATTTATTGATTTTTTGGTATTAAATACCCTAAAAGTTCCTAACTATTGTTTTTTTTTTTT

Personal tools