Specimen 230 - Manuel Vargas

From GGCWiki
Jump to: navigation, search

Location of collection: GGC 4

Date of collection: August 2012

Shannon-Wiener Index of Biodiversity: H'= 3.699

Photo:

230-1.JPG
230ecology.JPG








Distinguishing morphological features of Order: This order includes moths and butterflies. Characterized by three features:scales covering the body, wings, and proboscis. Mouth parts are characterized by a coiled tube at rest for sucking. It has long and slender antennas.


Sub-order ? Family ? After sequencing, genus and species ? Arthropoda Insecta Lepidoptera Sesiidae Carmenta pyralidiformis

Geographical Distribution:


Life cycle: egg to larva to pupa to adult


Sexual dimorphism:


What it eats: eats on live plant matter. The larvae feed on the roots of boneset, a wetland plant found along streams and ditch banks


Habitat: All terrestrial habitats from deserts to rainfall, lowland to grassland to mountain plateaus


Ecological Importance: Play an important in the natural ecosystem as pollinators and as food in the food chain.


Economic/agricultural/human health importance: The larvae of this order are very problematic to vegetation in agriculture


PCR product: gel picture?


Sequence data: TACTCTTANTCTTTTAATTCGTGCTGAATTAGGAACTCCAGGGTCACTAATTGGCGACGATCAAATTTATAATACTATTGTAACTGCACATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAAT TGGAGGATTTGGAAATTGACTTGTTCCCCTAATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAACAATATAAGATTCTGACTTTTACCTCCCTCTCTTATATTATTAATTTCAAGAAGAATTGTAGA AAATGGAGTAGGAACAGGATGAACTGTTTATCCTCCCCTCTCTTCTAACATTGCTCATGGGGGAAGTTCTGTAGATCTTGCTATTTTTTCACTTCATTTGGCGGGAATTTCTTCAATTTTAGGGGCTGTTAA TTTTATTACAACAATTATTAATATACGTCCAATTAATATATCCCTAGATCAAATACCTTTATTTGTTTGATCTGTGGGTATTACTGCTCTTCTTCTTCTTCTTTCTTTGCCTGTTTTAGCTGGAGCTATTAC TATACTTTTAACAGATCGAAATTTAAATACATCATTTTTCGATCCTGCTGGAGGGGGAGATCCTATTCTATACCAGCATTTATTTTGATTTTTTG

Personal tools