Specimen 234- Ruby Guerrero

From GGCWiki
Jump to: navigation, search
IMG 0443.JPG

Location of collection:

GGC 4

Date of collection:

August 2012

Shannon-Wiener Index of Biodiversity:

3.699

Distinguishing morphological features of Order:

Mouth

  • chewing mouthparts

Eyes

  • compound eyes well developed

Body

  • tarsi ussually 5 segments

Wings

  • Triangular stigma in front wings
  • Hind wings smaller than front wings, linked together by small hooks
  • Narrow juntion bewteen thorax and abdomen except in sawflies and horntails

Sub-order insecta

Family Formicidae

genus Formica

species

Geographical Distribution: Worldwide except for the polar regions

Life cycle: Egg--> Larva --> Pupa--> adult

Sexual dimorphism: Females of some hymenoptera carry and lay eggs

What it eats:

larva

  • feed by regergitation by adult insects
  • other larva are laid inside host and consume it from the inside out

Adult

  • feed on plants
  • hunt for food
  • feed on nectar

Habitat: Just about anywhere, can relocate to find food and resorces

Ecological Importance: Most Hymenoptera are extremly beneficial either as natural enemies of insect pest and pollinators of flowering plants

Economic/agricultural/human health importance:

  • pollinators
  • food source

PCR product:

Sequence data:

GAGCTGGNNNNTNGGATCTTCTATAAGTATAATTATTCGATTAGAATTAGGT TCTTCAAATTCATTAATTAATAATGATCAAATTTATAATTCTTTAGTAACTAA TCATGCCTTTATTATAATCTTTTTTATAGTAATACCATTTATAATTGGTGGAT TTGGAAATTTTCTAATTCCTTTAATATTAGGATCGCCAGATATAGCTTATCCTC GTATAAATAATATAAGATTTTGACTTTTACCTCCTTCCATCACTCTATTACTTTT AAGAAACTTTATTAATGATGGTACTGGAACTGGGTGAACTATCTACCCTCCTTTAG CTTCAAATATTTTTCATAATGGGCCTTCTGTAGACTTAACAATTTTTTCTCTTCAT ATTGCCGGTATATCATCTATTTTAGGAGCTATTAATTTTATTTCAACAATCCTTAA TATACATCATAAAAATTTTTCTATTGATAAAATTCCCCTACTTGTATGATCTATCTT AATCACTGCAATTTTACTTTTATTATCCCTTCCCGTTTTAGCTGGAGCTATTACAAT ATTATTAACTGATCNNAACTTAAATACTTCATTTTTTTGATCCTTCAGGAGGGGGAGAC CCGATTCTATATCAACATTTATTTTGATTTTTTGGTCACCC

Personal tools