Specimen 237 - Brett Roberts

From GGCWiki
Jump to: navigation, search

Location of collection:

GGC4

Date of collection:

August 2012

Shannon-Wiener Index of Biodiversity:

H'= 3.69

Tri237.JPG

Distinguishing morphological features of Order:

Moth-like in appearance

Mouth

-sucking, coiled tube at rest

Wings

-Large membranous, forward wings longer than hind wings, wings covered in scales

Atennae

-slender and long, sometimes plumose

Sub-order

Family

Glyphidoceridae

After sequencing, Genus and species

Glyphidocera juniperella

Geographical Distribution:


Life cycle:

Egg-> larvae-> Pupa-> Adult

Sexual dimorphism:


What it eats:Larval/nymphal stage Adult stage


Habitat: Larval/nymphal stage Adult stage


Ecological Importance: Larval/nymphal stage Adult stage


Economic/agricultural/human health importance: Larval/nymphal stage Adult stage


PCR product: gel picture?


Sequence data:

NNNNNNNNNNNNNNNNNNNNTNGNATTTGATCCGGATTAATTGGAACTTCCCTCAGTCTTTTAATTCGAGCAGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGG

ATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCACCAGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGACTTCTTCCTCCCTCTCTTTCATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGCACAGGTTGAACTGTTTATCCACCTTTATCTTCTAATATTGCTCATA

GAGGCTCTTCTGTTGATTTAGCTATTTTCTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTACTACTATTATTAACATAAAACTTAATAATTTATCTTTTGATCAATTACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTCTTCTTCTTCTTCTTTCTTTACCT

GTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGTGATCCTATTTTATACCAACATTTANNTGATTTTTTGNNNNNNNNN

Personal tools