Specimen 244 - Rocio Balbuena

From GGCWiki
Jump to: navigation, search
Hymenoptera 1.JPG

Contents

Location of collection:


GGC site 4

Date of collection:


August 2012

Shannon-Wiener Index of Biodiversity:


H'=3.69

Distinguishing morphological features of Order:


  • Body often considered "wasp-like" and constricted between thorax and abdomen
  • Forewings are usually a little larger than hind wings
  • Antennae are usually fairly long
  • Mouthparts are chewing and usually have well developed chewing mandibles

Sub-order?



Family?

Formicidae


After sequencing, genus and species?


Formica fusca with a 96% match.

Geographical Distribution:



Life cycle:



Sexual dimorphism:


Sex is determined by number of chromosomes.

What it eats:Larval/nymphal stage Adult stage


  • Plants
  • Nectar or pollen
  • Parasitic
  • Small insects

Habitat: Larval/nymphal stage Adult stage



Ecological Importance: Larval/nymphal stage Adult stage



Economic/agricultural/human health importance: Larval/nymphal stage Adult stage



PCR product: gel picture?



Sequence data:

NNNNNNNNNNNNNNNNTGCTNTCTGAGCTGGATAATTGGATCTTCTATAAGTATAATTATTCGATTAGAATTAGGTTCTTCAAATTCATTAATTAATAATGATCAAATTTATAATTCTTTAGT AACTAATCATGCCTTTATTATAATCTTTTTTATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCGCCAGATATAGCTTATCCTCGTATAAATAATA TAAGATTTTGACTTTTACCTCCTTCCATCACTCTATTACTTTTAAGAAACTTTATTAATGATGGTACTGGAACTGGGTGAACTATCTACCCTCCTTTAGCTTCAAATATTTTTCATAATGGGCC TTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCCNGNATATCATCTATTTTAGGAGCTATTAATTTTANTTTCNACAATCCTNAANATACNTCATAAAAATTTTTCNATTGANAAANNNN CCCTACNTGNATGATCTATCTNAATCACTGNNNNNNNNNTTNNNTATCCNNTCNNNTTNNNNNGGNNNNNNNNNNNNNNNTNNNNNNNNNNNAACTNNNNNNNNNNNTTTT NNNNNNNNNNNNNNGGNNNNNNNNNNCTNNNNNNNNNNTTANNNNNNTTTNNNNNNNNNNNNNNNNNNNNNN


Main Pages


Return to Hymenoptera Fall 2012 home page.

Return to The DNA Barcoding Project home page.


Other specimens done by Rocio Balbuena this term


Specimen 243 - Rocio Balbuena

Specimen 245 - Rocio Balbuena

Specimen 246 - Rocio Balbuena

Specimen 247 - Rocio Balbuena

Personal tools