Specimen 245 - Rocio Balbuena

From GGCWiki
Jump to: navigation, search
Homoptera 2.JPG

Contents

Location of collection:


GGC site 4

Date of collection:


August 2012

Shannon-Wiener Index of Biodiversity:


H'=3.69

Distinguishing morphological features of Order:


Mouthparts:

  • are similar to Hemiptera
  • include sucking formed into the beak
  • is usually segmented, and rising from the back of the head

Wings:

  • come in 4
  • forewings are usually leathery or membranous, uniform texture throughout
  • wings rest roof-like over the abdomen

Antennae:

  • short, and bristle-like
  • or, long and slender

Sub-order?



Family?


Cicadellidae

After sequencing, genus and species?


Graphocephala coccinea with an 84% match.

Geographical Distribution:



Life cycle:



Sexual dimorphism:



What it eats:Larval/nymphal stage Adult stage



Habitat: Larval/nymphal stage Adult stage



Ecological Importance: Larval/nymphal stage Adult stage



Economic/agricultural/human health importance: Larval/nymphal stage Adult stage



PCR product: gel picture?



Sequence data:


GGANTTGATCAGGTNTAGTAGGAATAATATTAAGAATAATTATTCGTATTGAATTAGCACAACCGGGCCCATTTTTAAATAATGATCAATTATATAATGTAATTGTTACTTCACATGCATTT ATTATAATTTTTTTTATAGTAATGCCAATTATAATTGGAGGATTTGGCAATTGACTACTGCCTTTAATAATTGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATGAGATTTTGACTT CTCCCCCCCTCATTAACTCTTCTTTTAGTTAGATCTATAGTTGAAATAGGGGTTGGGACAGGATGAACTGTTTATCCCCCATTATCTGCAAATATTGCACACTCAGGTGCGAGAGTTGAT CTCGCAATTTTTTCATTACATTTAGCAGGTATTTCCTCAATTCTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGAAGAATTGGTATAGACTTTGATCGTACTCCTTTATTT GTGTGATCTGTGTTAATTACAGCAATTTTATTACTTTTATCCCTCCCTGTTTTAGCAGGAGCTATTACGATACTTTTAACAGATCGAAATATTAATACTTCTTTTTTTGACCCTTCT GGGGGAGGTGACCCTATTTTGTACCAACATTTANNTGATTTTTTGGTCACCC

Main Pages


Return to Homoptera Fall 2012 home page.

Return to The DNA Barcoding Project home page.


Other specimens done by Rocio Balbuena this term


Specimen 243 - Rocio Balbuena

Specimen 244 - Rocio Balbuena

Specimen 246 - Rocio Balbuena

Specimen 247 - Rocio Balbuena

Personal tools