Specimen 259 - Russell Corley

From GGCWiki
Jump to: navigation, search

Location of Collection: GGC site #1

Date of Collection: August 2012

Shannon-Wiener Biodiversity Index: 3.59

Photo:

IMG 0037.JPG




Distinguishing morphological features of Order: Body is often wasp like and is constricted between thorax and abdomen. Wings when present are membranous with fore wings slightly larger than hind wings. Hooks on anterior margin of hind wings that are used to couple wings together during flight. Antennae are usually very long, tarsi are segmented. Ovipositor long and sometimes well developed into stinger. Mouth parts are always chewing with well developed mandibles, maxillae and labium elongated into sucking tongue.

Sub-order ? Family ? After sequencing, genus and species ?

Geographical Distribution:

Life cycle:

Sexual dimorphism:

What it eats:Larval/nymphal stage Adult stage

Habitat: Larval/nymphal stage Adult stage

Ecological Importance: Larval/nymphal stage Adult stage

Economic/agricultural/human health importance: Larval/Nymphal stage Adult stage

PCR/ Gel Picture: Not Available


Sequence data:

AATATTTCGGTCAGTTAAAAGCATTGTAATAGCTCCTGCTAAAACTGGTAGTGATAATAATAAAAGAACTGCTGTGATTAATACAGATCATACAAATAGTGGGGTTTGATGTAATGTTATACCAGCTGATCGTATATTTATTACTGTTGTGATAAAATTAATTGCTCCCAAGATTGATGAAATTCCTGCTAAGTGTAGTGAAAAAATGGATATATCAACTCTAGGACCAGCATGGGCGATATTTCTAGAAAGAGGGGGGTAGACAGTTCATCCTGTACCAACTCCTATTTCAACTAGAGATCTCATTAGAAGTAATGTTAATGATGGAGGTAATAGTCAAAATCTTATGTTATTAAGACGAGGAAACGCTATATCTGGTGCACCAATTATTAAAGGAAGTAACCAATTACCAAATCCACCAATTATAATTGGNATAACTATAAAAAAAATTATAATGAAAGCATGGGATGTAACAATTACGTTATAGATTTGACTATTATTAAAAAAAAATAATGATCTCGGNTGTGAAAGTTCAATCCGAATAATTATTCTTAATATTATNCCAATCATTCCTGATCAAATACCGAATAAAAAGNNCAAAGTACCANTATCTTTATGAT


Arthropoda, Insect, Hymenoptera, Formicidae, Hypoponera (55.35% accuracy)

Genus of Ants- Hypoponera


-Some other results came back as to the Taxa of this insect, but the only one that had a higher percentage on the Blast Database was a subfamily of Hemipterans called Deltocephalinae. Don't think this sequence is correct though because there are several repeats throughout the sequence as well as nucleotides that were not recognizable.

Personal tools