Specimen 270- Chris Maclafferty

From GGCWiki
Jump to: navigation, search

Hym2.jpg H' Value= 3.699


Location of collection: GGC 4

Date of collection: August 2012

Shannon-Wiener Index of Biodiversity: H'=3.699

Photo:

Distinguishing morphological features of Order: 1)Body often constricted between thorax and abdomen. 2)Four membranous wings. 3)Fairly long antennae. 4)Well developed ovipositor, sometimes for stinging. 5)Mouth parts consist of chewing mandible.


Sub-order ? Family ? After sequencing, genus and species ? Apocrita, Camponotus, steromyia, carbonifera

Geographical Distribution: World wide in temperate climates, prefer to live in wooded areas because these are carpenter ants and the wood supplies structure for housing.

Life cycle: Queens build nests, and take care of the first brood. The subsequent broods after development are cared for by the first brood. After development there is a splitting into two groups, major workers and minor workers.

Sexual dimorphism: There is one queen that develops from a fertilized egg. The rest of the colony is made of males who are from unfertilized eggs.

What it eats:Larval/nymphal stage Adult stage Larvae are fed by the queens salivary glands. Adults are responsible for feeding the larvae, pupae and themselves.

Habitat: Larval/nymphal stage Adult stage Larvae live within the colony along with the pupae. Adults also report to the colony.

Ecological Importance: Larval/nymphal stage Adult stage Decomposition of wood and provide a service in competing with and controlling other species of ants. Can be pests when inhabiting wood that is used for buildings.

Economic/agricultural/human health importance: Larval/nymphal stage Adult stage Can destroy buildings similar to their cousin the termite, but don't consume the wood like the termites do. Supply a food source to other species in the ecosystem.

PCR product: gel picture?

N/A Sequence data: NTAATTAATACNGATNATGTAAAAAGAGAANTTTGATCAAAATTTAAAAATTTAATTTTTATGTTTAGTATTGTTGAAATAAAATTAATTGCTCCTAAAATTGATGAAATTCCAGCAATATGTAAAGAAAAAATTGAAAAATCTACAGACGATCCTGTATGTGCAATAATTGAAGATAAAGGAGGATAAACAGTTCAACCTGTTCCTGTTCCTGTTTCTACTATTCTTCTAGTTAATAATAAAGTTAAAGAGGGAGGTAATAATCAAAATCTTATATTATTTATTCGTGGAAAAGCTATATCAGGGGCTCCTAATATAATAGGAATTAATCAATTTCCAAATCCTCCAATTAAAATTGGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCAGTAACAATTACATTATAAATTTGATCATTACCAATTAAATTTGAAATTGCCCTTAATTCTAATCGAATTAAAATTCTTAAAGAAGTTCCAACTATTCCTGCTCAAATACCAAAAATAAAATAAAGAGTTCCAATATCTTTATGANTTTGNTG

Personal tools