Specimen 274 - Julie McGarr

From GGCWiki
Jump to: navigation, search
Julie.274.jpg

Contents

Location of collection:


GGC Site 4

Date of collection:


August 2012

Shannon-Wiener Index of Biodiversity:


H'= 3.69

Distinguishing morphological features of Order:


The order Lepidoptera, which means 'scaly wings', is one of the most well known and easily recognizable orders of insects. This group includes moths and butterflies. Below are the main characteristics:

  • 2 pairs of membranous wings that are covered in tiny scales which overlap like shingles on a roof. A few moths are wingless
  • Large compound eyes
  • One ocelli present above each eye
  • Antennae present. Antennae are long and slender in female moths and generally feathery in male moths. Butterflies have clubbed antennae
  • Mouthparts are formed into a sucking tube known as a haustellum

The larvae are typically known as caterpillars and have a sclerotised head with chewing (mandibulate) mouthparts, 3 pairs of thoracic legs and often short, unsegmented prolegs on the abdomen.

Sub-order:


No recognized taxon, under moth category classified as sub-order Heterocera.

Family:


Gelechiidae

After sequencing, genus and species


Untomia albistrigella at 100% maximum identity in BOLD database.

Geographical Distribution:


Worldwide

Life cycle:


These insects undergo complete metamorphosis, that is, the young go through four stages: egg, larva, pupa, and adult. The larval stage does most of the eating and growing, with the adults often staying alive just long enough to mate and lay eggs. Many species have one generation per year; others may have from two to several generations; a few species take more than one year to develop. Adult lifespan ranges from as short as a few days up to several months.

Sexual dimorphism:


In some families sexual dimorphism is quite common, whereas females and males from other families look more or less the same - at least with respect to their wing patterning. However, even in families with no apparent sexual dimorphism, female and male moths or butterflies can be distinguished. Usually, females have a bigger abdomen that is filled with eggs. Moreover, in several moth families the antennae of the male moths are enlarged and feathery to allow sensing of pheromones released by the female moths of the respective species who have more threadlike antennae.

Food:


Depending on species, larvae may feed on all parts of herbaceous plants, roots/twigs/stems/leaves of trees and shrubs, fungi, lichens, dead or decaying plant material, stored food products, fabrics made of cotton or wool, or generally any organic material; many species are very host-specific, and can be identified by the plant they are feeding on. Larvae of a few species are known to eat other caterpillars, and a few other species eat soft-bodied insects such as aphids. Most adults feed mainly on nectar from flowers of a great variety of woody and herbaceous plants; secondary foods include sugary secretions (honeydew) from insects, juices of decaying fruit, tree sap, and manure liquids. Some adult moths in several families have either no mouthparts or non-functional mouthparts, and therefore do not feed as adults.

Habitat:


Larvae may be found anywhere on their host plant, on all plant parts including flowers, seeds, leaves, fruit, bark, wood and roots. Adults are generally found near the larval host plant. Moths are mostly nocturnal and may be attracted to lights at night or observed during the day resting in dark crevices or camouflaged on surrounding surfaces.

Ecological Importance:


  • Adults pollinate many plants whose flowers attract them with sugar-rich nectar.
  • Larvae browse certain parts of plants, including seeds and flowers, influencing the plants’ shape.
  • Many predators and parasites feed off them.

Economic/agricultural/human health importance:


Moths, and particularly their caterpillars, are a major agricultural pest in many parts of the world. The caterpillar of the gypsy moth causes severe damage to forests in the northeast United States, where it is an invasive species. Several moths in the family Tineidae are commonly regarded as pests because their larvae eat fabric such as clothes and blankets made from wool or silk. On the other hand, some moths are farmed. The most notable of these is the silkworm, the larva of the domesticated moth Bombyx mori. It is farmed for the silk with which it builds its cocoon. There are several species of Saturniidae that are also farmed for their silk. The mopane worm from the family Saturniidae is considered a significant food resource in southern Africa.

PCR product: gel picture


Not applicable.

Sequence data:


NNNNNNNNNNNNNNNNNNNTNGGNNTCTGAGCAGGTNTAATTGGTACATCTCTTAGATTACTAATTCGAGCTGAATTAGGAAATCCAGGACAATTAATTGGTGATGATCAAATTTACAACACTATTGT TACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGACTTGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAA GATTTTGATTATTACCCCCTTCTCTAATACTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATAGAGGAAGATCAGTG GATCTTGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTG AGCAGTAGGTATCACAGCTTTATTACTTTTACTTTCTTTACCTGTATTAGCTGGTGCTATTACTATATTACTTACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTA TTCTTTATCAACATCTATTTTGATTTTTTGGTCANN

Other specimens done by Julie McGarr



Return to The DNA Barcoding Project home page.
Personal tools