Specimen 277 - Julie McGarr

From GGCWiki
Jump to: navigation, search
Julie.277.jpg

Contents

Location of collection:


GGC Site 4

Date of collection:


August 2012

Shannon-Wiener Index of Biodiversity:


H'= 3.69

Distinguishing morphological features of Order:


The order Hymenoptera, which means 'membrane wings', is one of the largest orders of insects comprising of sawflies, wasps, bees and ants. However, all hymenopterans share the following characteristics:

  • Two pairs of membranous wings, although some may be wingless such as some species of female wasps and the worker caste of ants
  • The forewings are larger than the hind wings and are held together by small hooks
  • Females usually have a hardened ovipositor, which may be modified for laying eggs, sawing, piercing or stinging
  • Most hymenopterans have a constriction between the first 2 segments of the abdomen, which is known as a 'wasp waist'
  • Chewing (mandibulate) mouthparts, although in some species such as bees the lower lip is modified to form a tongue
  • Compound eyes, usually large

The larvae of hymenopterans lack many of the above external features. Most are grub-like with no legs.

Sub-order:


Apocrita are a suborder of insects in the order Hymenoptera.

Family:


Formicidae

After sequencing, genus and species


Formica fusca at 99% maximum identity in BLAST database.

Geographical Distribution:


Worldwide and throughout North America, from coastal habitats to the alpine.

Life cycle:


Ants have a complete life cycle (stages consist of egg-larvae-pupa-adult), which varies slightly depending on the species. New reproductives, take flight to find a common mating ground marked by the males mating pheromone. Males die shortly after mating, and females tear off their wings after mating, or just before entering a nesting site, and of course remain wingless for the rest of their lives of one to 20+ years. Nest-founding queens typically rear the first brood of small workers (always female) alone, but almost never after the first workers emerge. A new worker spends the first few days of its adult life caring for the queen and young. She then graduates to digging and other nest work, and later to defending the nest and foraging. Lifespan of workers live from 1 to 3 years. Males, however, survive for only a few weeks. Larger colonies consist mostly of sterile wingless females forming castes of workers and soldiers. Nearly all ant colonies have some fertile males called drones and one or more fertile females called queens. And many female species can asexually reproduce through parthenogenesis.

Sexual dimorphism:


Female larger.

Food:


Food varies by genus and species. Most species are to a greater or lesser degree predators or scavengers, and have a sweet-tooth, gathering extrafloral or less often floral nectar, hemipteran honeydew, or fruit juice for their sugar content. Larvae can eat solid food, while adults have a very narrow oesophagus and feed only on liquids or very small particles such as pollen. Adults often obtain partially digested, liquid food, regurgitated to them by the larvae.

Habitat:


Most North American species nest in soil, in leaf litter, or in dead wood.

Ecological Importance:


Ants perform many ecological roles that are beneficial to humans, including the suppression of pest populations, aeration of the soil, and dispersing of seeds. Some ants obtain nectar from flowers, although pollination by ants is somewhat rare.

Economic/agricultural/human health importance:


Agriculturally, ants digging through the soil aerates it and helps promote plant growth. Some ants of the family Ponerinae have toxic venom and are of medical importance. In some parts of the world (mainly Africa and South America), large ants are used as surgical sutures. On the other hand, ants may become nuisances when they invade buildings, or cause economic losses.

PCR product: gel picture


Not applicable.

Sequence data:


TGCTNTCTGAGCTGGANTAATTGGATCTTCTATAAGTATAATTATTCGATTAGAATTAGGTTCTTCAAATTCATTAATTAATAATGATCAAATTTATAATTCTTTAGTAACTAATCATGCCTTTATTA TAATCTTTTTTATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATATTAGGATCGCCAGATATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCT TCCATCACTCTATTACTTTTAAGAAACTTTATTAATGATGGTACTGGAACTGGGTGAACTATCTACCCTCCTTTAGCTTCAAATATTTTTCATAATGGGCCTTCTGTAGACTTAACAATTTTTTCTCT TCATATTGCCGGTATATCATCTATTTTAGGAGCTATTAATTTTATTTCAACAATCCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCCCTACTTGTATGATCTATCTTAATCACTGCAA TTTTACTTTTATTATCCCTTCCCGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAACTTAAATACTTCATTTTTTGATCCTTCAGGAGGGGGAGACCCGATTCTATATCAACATTTATTT TGATTTTTTG

Other specimens done by Julie McGarr



Return to The DNA Barcoding Project home page.
Personal tools