Specimen 402: Hope Tranberg & Kristina Ortiz

From GGCWiki
Jump to: navigation, search

Location of collection: GGC Site 2

Date of collection: Fall 2012

Shannon-Wiener Index of Biodiversity: H': 3.5788

IMG 0168.jpg

Distinguishing morphological features of Order: (true spider)

  • almost all spiders have five segments in the abdomen
  • secretion of silk thread at the end of the abdomen
  • almost all can inject venom
  • 4 pairs of "legs"


However, the following species in the photo is not a spider, but a mite, which falls in the arachnida family. characteristics of the arachnida family consists of:

  • Most adult mites have four pairs of legs, sometimes less.
  • Mouthpart: may be adapted for biting, stinging, sawing or sucking
  • Many mites are eyeless

Sub-order ? Family ? After sequencing, genus and species

Geographical Distribution:

Life cycle:

Sexual dimorphism:

What it eats:Larval/nymphal stage Adult stage

Habitat: Larval/nymphal stage Adult stage

Ecological Importance: Larval/nymphal stage Adult stage

Economic/agricultural/human health importance: Larval/nymphal stage Adult stage


Electrophoresis run:

Lane 8 contains specimen (highlighted in yellow).

402 run.jpg

Sequence:

TCAGGNATAATAGGGCTTAGCCTAAGAGCTGTTATTCGTATAGAATTAGGGCAACCAGGTCAATTAATCT

CCAACGACCAATTGTACAATAGAATTGTGACAGCCCACGCCTTTATTATAATTTTCTTTATAGTTATACC

TATCATAATCGGTGGTTTTGGAAACTGATTGGTTCCAATTATGATTGGAGCTCCAGACATAGCTTTCCCC

CGTATAAACAATATAAGCTTCTGACTTCTCCCCCCCTCATTAATGCTATTAGTTTTAGCATCATTTGTTA

ATATAGGAGTTGGAACCGGATGGACACTATACCCACCTTTATCAAGATTTTTAGCTCACAGATATGCCTC

TATTGAGCTATCCATTTTTTCTTTACATCTAGCTGGAGCTGCTTCAATTTTGGGAGCAATCAACTTTCTT

ACTACATTTAAAAATATAAGTAACAAAAATCTCTGATGAGATATGATCCCTTTATTTGTATGAGCTATTA

TAATTACAGTTATCCTTTTATTGTTGTCTCTACCAGTACTAGCTGGAGCAATTACTATACTTCTAATAGA

CCGTAATTTTAACACTACTTTCTTTGATCCGTCTGGAGGGGGGGATCCCATCATATATCAACACTTATTT

TGATTTTTTGGTCACCCTGAAGTTTAGTC


Bold System: (98.33%)

Phylum: Arthropoda

Order: Trombidiformes


NCBI Blast: (86%)

Genus: Leptus


Return to the Aranea Spring 2013 page.

Return to The DNA Barcoding Project home

Personal tools